SEND YOUR ORDERS DIRECTLY TO SYNGEN BY E-MAIL! Address: sales@syngendna.com E-MAIL (ORDER) INSTRUCTIONS: Each item of the order is associated with a keyword. Keywords are on separate lines. The order begins with keyword BEGIN and ends with keyword END. Values associated to each keyword can be on the same line (separated by a space) and/or on the following line. After OLIGOS and before END you can only describe your oligos. Comments can be added after COMMENT. Oligos are specified line by line with fields separated by tabs. Sequences are always 5'- sequence - 3' NAME SEQUENCE QUANTITY-(scale-umols) PURIFICATION (NO, OPC, PAGE, HPLC, SUP) Example: Oligo_name1 ACGTACGTACGTACGTACGT .2 NO The name of the oligo must not exceed 10 letters or digits and must not contain a space(s). Each line is terminated by a linefeed ("enter") or a return ASCII code. Copy the below format to your e-mail, fill in the (blanks) and send your orders directly to sales@syngendna.com cut here--------------------------- BEGIN NAME (your name) SHIP_ADDR (your delivery address) PHONE (your phone - important) FAX (your fax number - important) REPLY (e-mail address where you will receive confirmation) BILL_ADDR (your billing address) PO_# (your purchase order # or use Credit Card below)) CC_# (include name on card & expiration date) FIN_CONC (final adjusted concentration, if requested) FORMAT (tubes or plates. Default is tubes) COMMENTS (Anything we should know that is not indicated above? I.e. where "z" = modifier not listed below) OLIGOS (Name1 CCTAGAACTTGATTACAACA .2 NO) (Name2 TTGACTAAGAATTACTCTCTCCAAA 1 HPLC) (Name3 ATGGTCCTCCTGAAATCTGA .05 NO) (Name4 TGGTGAAGCCTATTCTTGGT .1 OPC) END cut here--------------------------------------- Authorized bases are: - UPPERCASE A, C, G, T for DNA bases and i for inosine. - lowercase a, c, g, u for RNA bases. - Degenerate base positions can be indicated either by writing the mixed bases in parentheses (), example: ATC(GT)AGGCT or by using the standard IUB code. - For a 5' modification, please add a lower case letter at the 5' end of the sequence. - For labels, please add a lower case letter at each place you want a labeling. a is amine C6 b is biotin p is phosphate t is thiol u is bromodeoxyuridine d is dU f is fluorescein h is HEX (ABI dye) k is TET (ABI dye) m is C6FAM (ABI dye) y is CY5 l is CY3 n is biotin-dT (internal) q is amine-dT z is anything else. IUB codes for oligos containing mixed sites: M = (AC) S = (GC) V = (AGC) R = (AG) Y = (CT) H = (ACT) W = (AT) K = (GT) D = (AGT) N = (AGCT) B = (GCT) For more information, please contact us - by Email: info@syngendna.com - by phone: (650) 212-0000 Thank you for choosing SynGen!